miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-519e-3p | ||||
miRNA Stemloop AC | MI0003145 | ||||
miRNA Stemloop ID | hsa-mir-519e | ||||
Sequence | aagugccuccuuuuagaguguu | ||||
TTD Target(s) Regulated by This miRNA | Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [1] | |
References | |||||
REF 1 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.