miRNA General Information
miRNA Mature ID	hsa-miR-601
miRNA Stemloop AC	MI0003614
miRNA Stemloop ID	hsa-mir-601
Sequence	uggucuaggauuguuggaggag
TTD Target(s) Regulated by This miRNA	Programmed cell death 1 ligand 1 (PD-L1)	Successful Target	Target Info	[1]
References
REF 1	Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.