miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-93-3p | ||||
| miRNA Stemloop AC | MI0000095 | ||||
| miRNA Stemloop ID | hsa-mir-93 | ||||
| Sequence | acugcugagcuagcacuucccg | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-3 (MMP-3) | Patented-recorded Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Cyclin-G2 | Regulated Protein | [2] | ||
| Disabled homolog 2 | Regulated Protein | [3] | |||
| E3 ubiquitin-protein ligase NEDD4-like | Regulated Protein | [4] | |||
| Programmed cell death protein 4 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | MicroRNA-93 regulates collagen loss by targeting MMP3 in human nucleus pulposus cells. Cell Prolif. 2015 Jun;48(3):284-92. | ||||
| REF 2 | MicroRNA-93 regulates cyclin G2 expression and plays an oncogenic role in laryngeal squamous cell carcinoma.Int J Oncol. 2015 Jan;46(1):161-74. | ||||
| REF 3 | Micro ribonucleic acid-93 promotes proliferation and migration of esophageal squamous cell carcinoma by targeting disabled 2.Thorac Cancer. 2015 Jul;6(4):524-33. | ||||
| REF 4 | miR-93 promotes TGF--induced epithelial-to-mesenchymal transition through downregulation of NEDD4L in lung cancer cells.Tumour Biol. 2016 Apr;37(4):5645-51. | ||||
| REF 5 | miR-93 functions as an oncomiR for the downregulation of PDCD4 in gastric carcinoma.Sci Rep. 2016 Mar 29;6:23772. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.