Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T03644 Target Info
Target Name Synuclein alpha (SNCA)
Synonyms PARK1; Non-A4 component of amyloid precursor; Non-A beta component of AD amyloid; NACP; Alpha-synuclein
Target Type Clinical trial Target
Gene Name SNCA
Biochemical Class Synuclein
UniProt ID
P37840
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-7-5p miRNA Info
miRNA Mature AC
MIMAT0000252
Sequence uggaagacuagugauuuuguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-7-5p by mature miRNA precursor transfection resulted in the decreased protein level of target SNCA. [2]
Evidence Score (E-score) 2 +
1 Western Blot [1]
2 Western Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Activated CDC42 kinase 1 (ACK-1) Target Info
ACK1_HUMAN
Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-34b resulted in significant reduction in SNCA mRNA expression and SNCA protein level. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-34c resulted in significant reduction in SNCA mRNA expression and SNCA protein level. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
References  Top
REF 1 Post-transcriptional regulation of alpha-synuclein expression by mir-7 and mir-153. J Biol Chem. 2010 Apr 23;285(17):12726-34.
REF 2 Repression of alpha-synuclein expression and toxicity by microRNA-7. Proc Natl Acad Sci U S A. 2009 Aug 4;106(31):13052-7.
REF 3 Inhibition of miR-34b and miR-34c enhances -synuclein expression in Parkinson's disease. FEBS Lett. 2015 Jan 30;589(3):319-25.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.