Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T09092 Target Info
Target Name Interleukin-10 (IL10)
Synonyms IL-10; Cytokine synthesis inhibitory factor; CSIF
Target Type Clinical trial Target
Gene Name IL10
Biochemical Class Cytokine: interleukin
UniProt ID
P22301
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism miR-19a was negatively correlated with the IL-10 expression. [1]
Evidence Score (E-score) 2 +
1 ELISA; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-98 inhibits IL-10 in B cells. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
2 qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism Rremarkable reduction of the wild-type 3'UTR reporter gene expression is shown in the presence of let-7c. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism A significant down-regulation in the luciferase expression in both cells with respect to control was observed when luciferase reporter vector containing the intact 3'UTR was transfected in Jurkat or Raji cells, while it was not seen in mutant 3'UTR construct lacking the predicted 27 base hsa-miR-106a binding site. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-503-3p miRNA Info
miRNA Mature AC
MIMAT0022925
Sequence gggguauuguuuccgcugccagg
miRNA Species Homo sapiens
Regulation Mechanism Inhibition of miR-503 expression facilitate secretion of IL-10. [7]
Evidence Score (E-score) 1 +
1 ELISA [7]
Representative Target(s) Regulated by This miRNA Interleukin-10 (IL10) Target Info
IL10_HUMAN
Interleukin-2 (IL2) Target Info
IL2_HUMAN
References  Top
REF 1 Micro RNA-19a suppresses interleukin-10 in peripheral B cells of patients with diabetic retinopathy. Am J Transl Res. 2017 Mar 15;9(3):1410-1417.
REF 2 Micro RNA-19a interferes with IL-10 expression in peripheral dendritic cells of patients with nasal polyposis. Oncotarget. 2017 Jul 25;8(30):48915-48921.
REF 3 miR-98 protects endothelial cells against hypoxia/reoxygenation induced-apoptosis by targeting caspase-3. Biochem Biophys Res Commun. 2015 Nov 20;467(3):595-601.
REF 4 Micro RNA-98 interferes with expression interleukin-10 in peripheral B cells of patients with lung cancer. Sci Rep. 2016 Sep 8;6:32754.
REF 5 Altered let-7 expression in Myasthenia gravis and let-7c mediated regulation of IL-10 by directly targeting IL-10 in Jurkat cells. Int Immunopharmacol. 2012 Oct;14(2):217-23.
REF 6 Posttranscriptional regulation of interleukin-10 expression by hsa-miR-106a. Proc Natl Acad Sci U S A. 2009 Apr 7;106(14):5761-6.
REF 7 Effect of miR-503 Down-Regulation on Growth and Invasion of Esophagus Carcinoma and Related Immune Function. Med Sci Monit. 2015 Nov 18;21:3564-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.