Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T34405 Target Info
Target Name Fractalkine (CX3CL1)
Synonyms Small-inducible cytokine D1; Small inducible cytokine D1; SCYD1; Neurotactin; NTT; FKN; CX3C membrane-anchored chemokine; C-X3-C motif chemokine 1; A-152E5.2
Target Type Literature-reported Target
Gene Name CX3CL1
UniProt ID
P78423
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
References  Top
REF 1 Upregulation of KSRP by miR-27b provides IFN--induced post-transcriptional regulation of CX3CL1 in liver epithelial cells. Sci Rep. 2015 Dec 3;5:17590.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.