Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T68211 Target Info
Target Name High mobility group protein HMG-I/Y (HMGA1)
Synonyms High mobility group protein R; High mobility group protein HMG-I/HMG-Y; High mobility group protein A1; High mobility group AT-hook protein 1; HMGIY; HMG-I(Y)
Target Type Literature-reported Target
Gene Name HMGA1
UniProt ID
P17096
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [1]
2 Proteomics [2]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-142-3p miRNA Info
miRNA Mature AC
MIMAT0000434
Sequence uguaguguuuccuacuuuaugga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [3]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
High mobility group protein B1 (HMGB1) Target Info
HMGB1_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-15 potentially targets HMGA1. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 qRT-PCR [6]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Regulation Mechanism HMGA1 is a direct target of miR-185-5p. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism HMGA1 is a direct target of miR-195. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Regulation Mechanism HMGA1 is a target of miR-296-5p. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-625-5p miRNA Info
miRNA Mature AC
MIMAT0003294
Sequence agggggaaaguucuauagucc
miRNA Species Homo sapiens
Regulation Mechanism miR-625 directly binded to the 3'UTR of HMGA1 and suppressed its expression. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Fragile histidine triad protein (FHIT) Target Info
FHIT_HUMAN
High mobility group protein HMG-I/Y (HMGA1) Target Info
HMGA1_HUMAN
miRNA Mature ID hsa-miR-1297 miRNA Info
miRNA Mature AC
MIMAT0005886
Sequence uucaaguaauucaggug
miRNA Species Homo sapiens
Regulation Mechanism HMGA1 is a direct target of miR-1297 and is negatively regulated by miR-1297. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA High mobility group protein HMG-I/Y (HMGA1) Target Info
HMGA1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
References  Top
REF 1 Distinct microRNA expression profile in prostate cancer patients with early clinical failure and the impact of let-7 as prognostic marker in high-risk prostate cancer. PLoS One. 2013 Jun 14;8(6):e65064.
REF 2 Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63.
REF 3 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 4 MiR-142-3p functions as a potential tumor suppressor in human osteosarcoma by targeting HMGA1. Cell Physiol Biochem. 2014;33(5):1329-39.
REF 5 Downregulation of HMGA-targeting microRNAs has a critical role in human pituitary tumorigenesis. Oncogene. 2012 Aug 23;31(34):3857-65.
REF 6 Involvement of microRNA-1297, a new regulator of HMGA1, in the regulation of glioma cell growth in vivo and in vitro. Am J Transl Res. 2016 May 15;8(5):2149-58.
REF 7 Two new miR-16 targets: caprin-1 and HMGA1, proteins implicated in cell proliferation. Biol Cell. 2009 Sep;101(9):511-24.
REF 8 Transgenic expression of microRNA-185 causes a developmental arrest of T cells by targeting multiple genes including Mzb1. J Biol Chem. 2013 Oct 18;288(42):30752-62.
REF 9 Downregulation of miR-195 promotes prostate cancer progression by targeting HMGA1. Oncol Rep. 2016 Jul;36(1):376-82.
REF 10 Epigenetic modulation of a miR-296-5p:HMGA1 axis regulates Sox2 expression and glioblastoma stem cells. Oncogene. 2016 Sep 15;35(37):4903-13.
REF 11 miR-625 suppresses cell proliferation and migration by targeting HMGA1 in breast cancer. Biochem Biophys Res Commun. 2016 Feb 19;470(4):838-44.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.