Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T98698 |
Target Info
|
| Target Name |
Histone deacetylase 7 (HDAC7) |
| Synonyms |
Histone deacetylase 7A; HDAC7A; HD7a; HD7 |
| Target Type |
Patented-recorded Target |
| Gene Name |
HDAC7 |
| Biochemical Class |
Carbon-nitrogen hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-140-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cagugguuuuacccuaugguag
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Adenosine deaminase (ADA)
|
Target Info
|
|
|
Aspartyl aminopeptidase (DNPEP)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Pioglitazone up-regulates long non-coding RNA MEG3 to protect endothelial progenitor cells via increasing HDAC7 expression in metabolic syndrome. Biomed Pharmacother. 2016 Mar;78:101-109.
|
| REF 2 |
Reciprocal effects between microRNA-140-5p and ADAM10 suppress migration and invasion of human tongue cancer cells. Biochem Biophys Res Commun. 2014 Jun 6;448(3):308-14.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
