miRNA General Information
miRNA Mature ID hsa-miR-142-5p
miRNA Stemloop AC MI0000458
miRNA Stemloop ID hsa-mir-142
Sequence cauaaaguagaaagcacuacu
TTD Target(s) Regulated by This miRNA Mothers against decapentaplegic homolog 3 (SMAD3) Successful Target Target Info [1]
NAD-dependent deacetylase sirtuin-1 (SIRT1) Clinical trial Target Target Info [2]
Transforming growth factor beta 2 (TGFB2) Clinical trial Target Target Info [3]
Nuclear factor erythroid 2-related factor 2 (Nrf2) Successful Target Target Info [4]
TGF-beta receptor type II (TGFBR2) Clinical trial Target Target Info [5]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [6]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [7]
Ras-related C3 botulinum toxin substrate 1 (RAC1) Literature-reported Target Target Info [8]
Beclin-1 (BECN1) Literature-reported Target Target Info [9]
Suppressor of cytokine signaling 1 (SOCS1) Literature-reported Target Target Info [10]
Protein(s) Regulated by This miRNA Claudin-1 Regulated Protein [11]
Insulin-like growth factor 2 mRNA-binding protein 3 Regulated Protein [12]
Transcription regulator protein BACH2 Regulated Protein [13]
Tumor protein p53-inducible nuclear protein 1 Regulated Protein [14]
Zinc finger E-box-binding homeobox 1 Regulated Protein [15]
References
REF 1 Rotavirus-induced miR-142-5p elicits proviral milieu by targeting non-canonical transforming growth factor beta signalling and apoptosis in cells. Cell Microbiol. 2016 May;18(5):733-47.
REF 2 Up-regulation of microRNA-142 in simian immunodeficiency virus encephalitis leads to repression of sirtuin1. FASEB J. 2013 Sep;27(9):3720-9.
REF 3 Upregulation of miR-142-5p in atherosclerotic plaques and regulation of oxidized low-density lipoprotein-induced apoptosis in macrophages. Mol Med Rep. 2015 May;11(5):3229-34.
REF 4 Identification of novel microRNAs in post-transcriptional control of Nrf2 expression and redox homeostasis in neuronal, SH-SY5Y cells. PLoS One. 2012;7(12):e51111.
REF 5 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 6 MiR-142 modulates human pancreatic cancer proliferation and invasion by targeting hypoxia-inducible factor 1 (HIF-1) in the tumor microenvironments. Biol Open. 2017 Feb 15;6(2):252-259.
REF 7 Epstein-Barr Virus (EBV)-BamHI-A Rightward Transcript (BART)-6 and Cellular MicroRNA-142 Synergistically Compromise Immune Defense of Host Cells in EBV-Positive Burkitt Lymphoma. Med Sci Monit. 2016 Oct 31;22:4114-4120.
REF 8 MiR-142 acts as a tumor suppressor in osteosarcoma cell lines by targeting Rac1. Oncol Rep. 2015 Mar;33(3):1291-9.
REF 9 Mesenchymal Stem Cells Alleviate LPS-Induced Acute Lung Injury in Mice by MiR-142a-5p-Controlled Pulmonary Endothelial Cell Autophagy. Cell Physiol Biochem. 2016;38(1):258-66.
REF 10 miR-142-5p and miR-130a-3p are regulated by IL-4 and IL-13 and control profibrogenic macrophage program. Nat Commun. 2015 Oct 5;6:8523.
REF 11 MicroRNA-142-5p contributes to Hashimoto's thyroiditis by targeting CLDN1.J Transl Med. 2016 Jun 8;14(1):166.
REF 12 Differentially expressed miRNAs in sepsis-induced acute kidney injury target oxidative stress and mitochondrial dysfunction pathways.PLoS One. 2017 Mar 15;12(3):e0173292.
REF 13 microRNA-142 is upregulated by tumor necrosis factor-alpha and triggers apoptosis in human gingival epithelial cells by repressing BACH2 expression. Am J Transl Res. 2017 Jan 15;9(1):175-183.
REF 14 Overexpression of miR-142-5p and miR-155 in gastric mucosa-associated lymphoid tissue (MALT) lymphoma resistant to Helicobacter pylori eradication.PLoS One. 2012;7(11):e47396.
REF 15 MicroRNA-142 is mutated in about 20% of diffuse large B-cell lymphoma.Cancer Med. 2012 Oct;1(2):141-55.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.