miRNA General Information
miRNA Mature ID hsa-miR-424-5p
miRNA Stemloop AC MI0001446
miRNA Stemloop ID hsa-mir-424
Sequence cagcagcaauucauguuuugaa
TTD Target(s) Regulated by This miRNA Fibroblast growth factor receptor 1 (FGFR1) Successful Target Target Info [1]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [2]
Fatty acid synthase (FASN) Successful Target Target Info [3]
Fibroblast growth factor-2 (FGF2) Successful Target Target Info [4]
Mothers against decapentaplegic homolog 3 (SMAD3) Successful Target Target Info [5]
ERK activator kinase 1 (MEK1) Clinical trial Target Target Info [1]
Checkpoint kinase-1 (CHK1) Clinical trial Target Target Info [6]
Wee1-like protein kinase (WEE1) Clinical trial Target Target Info [6]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [6]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [7]
M-phase inducer phosphatase 1 (MPIP1) Literature-reported Target Target Info [6]
G1/S-specific cyclin-E1 (CCNE1) Literature-reported Target Target Info [6]
Lysine-specific demethylase 5B (KDM5B) Literature-reported Target Target Info [8]
Cyclin D (CCND3) Literature-reported Target Target Info [9]
IP3 receptor isoform 1 (ITPR1) Literature-reported Target Target Info [1]
Protein(s) Regulated by This miRNA Anillin Regulated Protein [6]
Cullin-2 Regulated Protein [7]
Cyclic AMP-dependent transcription factor ATF-6 alpha Regulated Protein [6]
Cyclin-F Regulated Protein [6]
Dual specificity protein phosphatase CDC14A Regulated Protein [6]
E3 SUMO-protein ligase PIAS1 Regulated Protein [1]
E3 ubiquitin-protein ligase SIAH1 Regulated Protein [13]
Homeobox protein CDX-2 Regulated Protein [14]
Kinesin-like protein KIF23 Regulated Protein [6]
Nuclear factor 1 A-type Regulated Protein [15]
Protein patched homolog 1 Regulated Protein [16]
Suppressor of cytokine signaling 2 Regulated Protein [17]
Suppressor of cytokine signaling 6 Regulated Protein [18]
Transcription factor PU.1 Regulated Protein [7]
Transforming growth factor beta receptor type 3 Regulated Protein [19]
Zinc finger protein PLAG1 Regulated Protein [20]
References
REF 1 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 2 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
REF 3 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 4 An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in pulmonary arterial hypertension. Nat Med. 2013 Jan;19(1):74-82.
REF 5 miR-424-5p promotes proliferation of gastric cancer by targeting Smad3 through TGF- signaling pathway. Oncotarget. 2016 Nov 15;7(46):75185-75196.
REF 6 Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6.
REF 7 Hypoxia-induced microRNA-424 expression in human endothelial cells regulates HIF- isoforms and promotes angiogenesis. J Clin Invest. 2010 Nov;120(11):4141-54.
REF 8 miR424-5p functions as an anti-oncogene in cervical cancer cell growth by targeting KDM5B via the Notch signaling pathway. Life Sci. 2017 Feb 15;171:9-15.
REF 9 miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404.
REF 10 Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6.
REF 11 Hypoxia-induced microRNA-424 expression in human endothelial cells regulates HIF- isoforms and promotes angiogenesis. J Clin Invest. 2010 Nov;120(11):4141-54.
REF 12 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 13 microRNA profiling in Epstein-Barr virus-associated B-cell lymphoma.Nucleic Acids Res. 2011 Mar;39(5):1880-93.
REF 14 MiR-424 regulates monocytic differentiation of human leukemia U937 cells by directly targeting CDX2.Biotechnol Lett. 2013 Nov;35(11):1799-806.
REF 15 The interplay between the master transcription factor PU.1 and miR-424 regulates human monocyte/macrophage differentiation.Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19849-54.
REF 16 Hypoxia-induced miR-424 decreases tumor sensitivity to chemotherapy by inhibiting apoptosis.Cell Death Dis. 2014 Jun 26;5:e1301.
REF 17 IL-8 induces miR-424-5p expression and modulates SOCS2/STAT5 signaling pathway in oral squamous cell carcinoma.Mol Oncol. 2016 Jun;10(6):895-909.
REF 18 MicroRNA-424-5p suppresses the expression of SOCS6 in pancreatic cancer.Pathol Oncol Res. 2013 Oct;19(4):739-48.
REF 19 TWIST1-Induced miR-424 Reversibly Drives Mesenchymal Programming while Inhibiting Tumor Initiation.Cancer Res. 2015 May 1;75(9):1908-21.
REF 20 miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia.Blood. 2009 Oct 8;114(15):3255-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.