miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-561-3p | ||||
| miRNA Stemloop AC | MI0003567 | ||||
| miRNA Stemloop ID | hsa-mir-561 | ||||
| Sequence | caaaguuuaagauccuugaagu | ||||
| TTD Target(s) Regulated by This miRNA | Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [1] | |
| Orphan nuclear receptor DAX-1 (NR0B1) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | MicroRNA-561 inhibits gastric cancercell proliferation and invasion by downregulating c-Myc expression. Am J Transl Res. 2016 Sep 15;8(9):3802-3811. | ||||
| REF 2 | MicroRNA-561 promotes acetaminophen-induced hepatotoxicity in HepG2 cells and primary human hepatocytes through downregulation of the nuclear receptor corepressor dosage-sensitive sex-reversal adrenal hypoplasia congenital critical region on the X chromosome, gene 1 (DAX-1). Drug Metab Dispos. 2014 Jan;42(1):44-61. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.