Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T64022 |
Target Info
|
| Target Name |
Importin beta (KPNB1) |
| Synonyms |
Pore targeting complex 97 kDa subunit; PTAC97; Nuclear factor p97; NTF97; Karyopherin subunit beta1; Karyopherin subunit beta-1; Importin90; Importin-90; Importin subunit beta1; Importin subunit beta-1 |
| Target Type |
Literature-reported Target |
| Gene Name |
KPNB1 |
| Biochemical Class |
Eukaryotic nuclear pore complex |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-30d-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uguaaacauccccgacuggaag
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-30d mimic significantly reduced the activity of the wild-type KPNB1 3 UTR reporter while having little effect on mutant KPNB1 3'UTR reporter activity. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Autophagy-related 2B (ATG2B)
|
Target Info
|
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
EZH2-miR-30d-KPNB1 pathway regulates malignant peripheral nerve sheath tumour cell survival and tumourigenesis. J Pathol. 2014 Feb;232(3):308-18.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
