Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T64245 Target Info
Target Name Apoptosis antigen ligand (CD178)
Synonyms Tumor necrosis factor ligand superfamily member 6; TNFSF6; FasL; Fas ligand; FAS antigen ligand; CD95L; CD95-L; CD95 ligand; CD178 antigen; CD178; APTL; APT1LG1
Target Type Literature-reported Target
Gene Name FASLG
Biochemical Class Cytokine: tumor necrosis factor
UniProt ID
P48023
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 6 +
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-3p miRNA Info
miRNA Mature AC
MIMAT0004494
Sequence caacaccagucgaugggcugu
miRNA Species Homo sapiens
Regulation Mechanism FASLG was the direct target of miR-21. [7]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-let-7e-5p miRNA Info
miRNA Mature AC
MIMAT0000066
Sequence ugagguaggagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism FASLG is a target of let-7e-5p. [8]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-149-5p miRNA Info
miRNA Mature AC
MIMAT0000450
Sequence ucuggcuccgugucuucacuccc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-149-5p resulted in decreased both mRNA and protein level of FASLG. [9]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
References  Top
REF 1 Regulation of the extrinsic apoptotic pathway by microRNA-21 in alcoholic liver injury. J Biol Chem. 2014 Oct 3;289(40):27526-39.
REF 2 miR-21 regulates N-methyl-N-nitro-N'-nitrosoguanidine-induced gastric tumorigenesis by targeting FASLG and BTG2. Toxicol Lett. 2014 Aug 4;228(3):147-56.
REF 3 The serum miR-21 level serves as a predictor for the chemosensitivity of advanced pancreatic cancer, and miR-21 expression confers chemoresistance by targeting FasL. Mol Oncol. 2013 Jun;7(3):334-45.
REF 4 MiR-21 down-regulation suppresses cell growth, invasion and induces cell apoptosis by targeting FASL, TIMP3, and RECK genes in esophageal carcinoma. Dig Dis Sci. 2013 Jul;58(7):1863-70.
REF 5 miR-21 modulates cell apoptosis by targeting multiple genes in renal cell carcinoma. Urology. 2011 Aug;78(2):474.e13-9.
REF 6 Foxo3a regulates apoptosis by negatively targeting miR-21. J Biol Chem. 2010 May 28;285(22):16958-66.
REF 7 MiR-21 up-regulation mediates glioblastoma cancer stem cells apoptosis and proliferation by targeting FASLG. Mol Biol Rep. 2015 Mar;42(3):721-7.
REF 8 Downregulation of let-7e-5p contributes to endothelial progenitor cell dysfunction in deep vein thrombosis via targeting FASLG. Thromb Res. 2016 Feb;138:30-36.
REF 9 Inhibition of MicroRNA-149-5p Induces Apoptosis of Acute Myeloid Leukemia Cell Line THP-1 by Targeting Fas Ligand (FASLG). Med Sci Monit. 2016 Dec 25;22:5116-5123.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.