Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T88321 |
Target Info
|
| Target Name |
Rhombotin-2 (LMO2) |
| Synonyms |
TTG2; T-cell translocation protein 2; RHOM2; RBTNL1; RBTN2; LMO-2; LIM-only protein 2; LIM-domain protein Lmo2; LIM domain only protein 2; Cysteine-rich protein TTG-2; Cysteine rich protein TTG-2 |
| Target Type |
Literature-reported Target |
| Gene Name |
LMO2 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-223-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugucaguuugucaaauacccca
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The overexpression of miR-223-3p resulted in the decreased protein level of target LMO2. |
[1] |
| Evidence Score (E-score) |
3 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; RNA-Binding Protein Immunoprecipitation; Western Blot |
[1] |
| 2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[2] |
| 3 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
ATM serine/threonine kinase (ATM)
|
Target Info
|
|
|
C-X-C motif chemokine 2 (CXCL2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-223 reversibly regulates erythroid and megakaryocytic differentiation of K562 cells. J Cell Mol Med. 2009 Nov-Dec;13(11-12):4551-9.
|
| REF 2 |
Reciprocal regulation of -globin expression by exo-miRNAs: Relevance to -globin silencing in -thalassemia major. Sci Rep. 2017 Mar 16;7(1):202.
|
| REF 3 |
MicroRNA 223-dependent expression of LMO2 regulates normal erythropoiesis. Haematologica. 2009 Apr;94(4):479-86.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.