Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T92477 | Target Info | |||
Target Name | Suppressor of cytokine signaling 3 (SOCS3) | ||||
Synonyms | STAT-induced STAT inhibitor 3; STAT induced STAT inhibitor 3; SSI3; SSI-3; SOCS-3; Cytokine-inducible SH2 protein 3; CIS3; CIS-3 | ||||
Target Type | Literature-reported Target | ||||
Gene Name | SOCS3 | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-203a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | gugaaauguuuaggaccacuag | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 3 | + | |||
Representative Target(s) Regulated by This miRNA | Apoptosis inhibitor survivin (BIRC5) | Target Info | |||
Apoptosis regulator Bcl-W (BCL-W) | Target Info | ||||
miRNA Mature ID | hsa-miR-155-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uuaaugcuaaucgugauagggguu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
Representative Target(s) Regulated by This miRNA | Acetyl-CoA transporter (SLC33A1) | Target Info | |||
Angiotensin II receptor type-1 (AGTR1) | Target Info | ||||
miRNA Mature ID | hsa-miR-19a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugugcaaaucuaugcaaaacuga | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
Representative Target(s) Regulated by This miRNA | Adrenergic receptor beta-1 (ADRB1) | Target Info | |||
Apoptosis signal-regulating kinase 1 (MAP3K5) | Target Info | ||||
miRNA Mature ID | hsa-miR-221-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | agcuacauugucugcuggguuuc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | SOCS3 3'UTR was significantly suppressed by miR-221 mimic. | [9] | |||
Evidence Score (E-score) | 2 | + | |||
Representative Target(s) Regulated by This miRNA | Bcl-2-binding component 3 (BBC3) | Target Info | |||
Beclin-1 (BECN1) | Target Info | ||||
miRNA Mature ID | hsa-miR-455-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaugugccuuuggacuacaucg | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
Representative Target(s) Regulated by This miRNA | Ribosomal protein S6 kinase beta-1 (S6K1) | Target Info | |||
Suppressor of cytokine signaling 3 (SOCS3) | Target Info | ||||
miRNA Mature ID | hsa-miR-15b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcagcacaucaugguuuaca | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Overexpression of miR-15b significantly reduced the levels of SOCS3 in hyperglycemia. | [12] | |||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
Checkpoint kinase-1 (CHK1) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | Identifying targets for topical RNAi therapeutics in psoriasis: assessment of a new in vitro psoriasis model. Arch Dermatol Res. 2013 Aug;305(6):501-12. | ||||
REF 2 | MicroRNAs: novel regulators involved in the pathogenesis of psoriasis PLoS One. 2007 Jul 11;2(7):e610. | ||||
REF 3 | Anti-miR-203 Upregulates SOCS3 Expression in Breast Cancer Cells and Enhances Cisplatin Chemosensitivity. Genes Cancer. 2011 Jul;2(7):720-7. | ||||
REF 4 | MiR-155 regulates the proliferation and apoptosis of pancreatic cancer cells through targeting SOCS3. Eur Rev Med Pharmacol Sci. 2019 Jun;23(12):5168-5175. | ||||
REF 5 | Borna disease virus encoded phosphoprotein inhibits host innate immunity by regulating miR-155. Antiviral Res. 2013 Apr;98(1):66-75. | ||||
REF 6 | EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21. | ||||
REF 7 | miR-19a: an effective regulator of SOCS3 and enhancer of JAK-STAT signalling. PLoS One. 2013 Jul 22;8(7):e69090. | ||||
REF 8 | Silencing microRNA-221/222 cluster suppresses glioblastoma angiogenesis by suppressor of cytokine signaling-3-dependent JAK/STAT pathway. J Cell Physiol. 2019 Dec;234(12):22272-22284. | ||||
REF 9 | MiR-221 accentuates IFNs anti-HCV effect by downregulating SOCS1 and SOCS3. Virology. 2014 Aug;462-463:343-50. | ||||
REF 10 | Pentagalloylglucose Inhibits the Replication of Rabies Virus via Mediation of the miR-455/SOCS3/STAT3/IL-6 Pathway. J Virol. 2019 Aug 28;93(18). pii: e00539-19. | ||||
REF 11 | Serum microRNA profiling and bioinformatics analysis of patients with type 2 diabetes mellitus in a Chinese population. Mol Med Rep. 2017 Apr;15(4):2143-2153. | ||||
REF 12 | miR-15b/16 protects primary human retinal microvascular endothelial cells against hyperglycemia-induced increases in tumor necrosis factor alpha and suppressor of cytokine signaling 3. J Neuroinflammation. 2015 Mar 4;12:44. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.