Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T96435 |
Target Info
|
| Target Name |
Sentrin specific protease-1 (SENP1) |
| Synonyms |
Sentrin/SUMO-specific protease SENP1; Sentrin-specific protease 1 |
| Target Type |
Literature-reported Target |
| Gene Name |
SENP1 |
| Biochemical Class |
Peptidase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
guccaguuuucccaggaaucccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-145 reduces SENP1 expression by inhibiting translation and/or causing mRNA instability. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot; Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Tumor-suppressive microRNA-145 induces growth arrest by targeting SENP1 in human prostate cancer cells. Cancer Sci. 2015 Apr;106(4):375-82.
|
| REF 2 |
CDX2/mir-145-5p/SENP1 Pathways Affect LNCaP Cells Invasion and Migration. Front Oncol. 2019 Jun 12;9:477.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
