miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-let-7g-3p | ||||
miRNA Stemloop AC | MI0000433 | ||||
miRNA Stemloop ID | hsa-let-7g | ||||
Sequence | cuguacaggccacugccuugc | ||||
TTD Target(s) Regulated by This miRNA | Monocyte chemotactic and activating factor (CCL2) | Clinical trial Target | Target Info | [1] | |
Cardiac myosin (MYBPC3) | Clinical trial Target | Target Info | [2] | ||
T-cell-specific protein RANTES (CCL5) | Clinical trial Target | Target Info | [1] | ||
References | |||||
REF 1 | miR-98 and let-7g* protect the blood-brain barrier under neuroinflammatory conditions. J Cereb Blood Flow Metab. 2015 Dec;35(12):1957-65. | ||||
REF 2 | H-ferritin-regulated microRNAs modulate gene expression in K562 cells. PLoS One. 2015 Mar 27;10(3):e0122105. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.