miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1228-3p | ||||
| miRNA Stemloop AC | MI0006318 | ||||
| miRNA Stemloop ID | hsa-mir-1228 | ||||
| Sequence | ucacaccugccucgcccccc | ||||
| TTD Target(s) Regulated by This miRNA | Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [1] | |
| BMP-2-inducible protein kinase (BMP2K) | Literature-reported Target | Target Info | [2] | ||
| Casein kinase II alpha prime (CSNK2A2) | Patented-recorded Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Modulator of apoptosis 1 | Regulated Protein | [4] | ||
| References | |||||
| REF 1 | miR-1228 promotes the proliferation and metastasis of hepatoma cells through a p53 forward feedback loop. Br J Cancer. 2015 Jan 20;112(2):365-74. | ||||
| REF 2 | Vitamin D activation of functionally distinct regulatory miRNAs in primary human osteoblasts. J Bone Miner Res. 2013 Jun;28(6):1478-88. | ||||
| REF 3 | Restoration of miR-1228* expression suppresses epithelial-mesenchymal transition in gastric cancer. PLoS One. 2013;8(3):e58637. | ||||
| REF 4 | miR-1228 prevents cellular apoptosis through targeting of MOAP1 protein.Apoptosis. 2012 Jul;17(7):717-24. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.