miRNA General Information
miRNA Mature ID	hsa-miR-1245a
miRNA Stemloop AC	MI0006380
miRNA Stemloop ID	hsa-mir-1245a
Sequence	aagugaucuaaaggccuacau
TTD Target(s) Regulated by This miRNA	Breast cancer type 2 susceptibility protein (BRCA2)	Literature-reported Target	Target Info	[1]
References
REF 1	Up-regulation of miR-1245 by c-myc targets BRCA2 and impairs DNA repair. J Mol Cell Biol. 2012 Apr;4(2):108-17.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.