miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-132-5p | ||||
| miRNA Stemloop AC | MI0000449 | ||||
| miRNA Stemloop ID | hsa-mir-132 | ||||
| Sequence | accguggcuuucgauuguuacu | ||||
| TTD Target(s) Regulated by This miRNA | Nuclear factor erythroid 2-related factor 2 (Nrf2) | Successful Target | Target Info | [1] | |
| Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | Porphyromonas gingivalis-induced miR-132 regulates TNF expression in THP-1 derived macrophages. Springerplus. 2016 Jun 17;5(1):761. | ||||
| REF 2 | Alteration of the microRNA network during the progression of Alzheimer's disease. EMBO Mol Med. 2013 Oct;5(10):1613-34. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.