miRNA General Information
miRNA Mature ID	hsa-miR-154-3p
miRNA Stemloop AC	MI0000480
miRNA Stemloop ID	hsa-mir-154
Sequence	aaucauacacgguugaccuauu
TTD Target(s) Regulated by This miRNA	Wnt-5a protein (WNT5A)	Literature-reported Target	Target Info	[1]
References
REF 1	MicroRNA-154 functions as a tumor suppressor in osteosarcoma by targeting Wnt5a. Oncol Rep. 2016 Mar;35(3):1851-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.