miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-185-3p | ||||
| miRNA Stemloop AC | MI0000482 | ||||
| miRNA Stemloop ID | hsa-mir-185 | ||||
| Sequence | aggggcuggcuuuccucugguc | ||||
| TTD Target(s) Regulated by This miRNA | RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Stromal interaction molecule 1 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677. | ||||
| REF 2 | MicroRNA-185 inhibits angiogenesis in human microvascular endothelial cells through targeting stromal interaction molecule 1.Cell Biol Int. 2016 Mar;40(3):318-28. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.