miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-187-5p | ||||
miRNA Stemloop AC | MI0000274 | ||||
miRNA Stemloop ID | hsa-mir-187 | ||||
Sequence | ggcuacaacacaggacccgggc | ||||
TTD Target(s) Regulated by This miRNA | Cytochrome P450 1B1 (CYP1B1) | Clinical trial Target | Target Info | [1] | |
Protein(s) Regulated by This miRNA | Aldehyde dehydrogenase family 1 member A3 | Regulated Protein | [2] | ||
References | |||||
REF 1 | MicroRNA-187-5p suppresses cancer cell progression in non-small cell lung cancer (NSCLC) through down-regulation of CYP1B1. Biochem Biophys Res Commun. 2016 Sep 16;478(2):649-55. | ||||
REF 2 | MiR-187 Targets the Androgen-Regulated Gene ALDH1A3 in Prostate Cancer.PLoS One. 2015 May 13;10(5):e0125576. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.