miRNA General Information
miRNA Mature ID hsa-miR-187-5p
miRNA Stemloop AC MI0000274
miRNA Stemloop ID hsa-mir-187
Sequence ggcuacaacacaggacccgggc
TTD Target(s) Regulated by This miRNA Cytochrome P450 1B1 (CYP1B1) Clinical trial Target Target Info [1]
Protein(s) Regulated by This miRNA Aldehyde dehydrogenase family 1 member A3 Regulated Protein [2]
References
REF 1 MicroRNA-187-5p suppresses cancer cell progression in non-small cell lung cancer (NSCLC) through down-regulation of CYP1B1. Biochem Biophys Res Commun. 2016 Sep 16;478(2):649-55.
REF 2 MiR-187 Targets the Androgen-Regulated Gene ALDH1A3 in Prostate Cancer.PLoS One. 2015 May 13;10(5):e0125576.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.