miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-18a-5p | ||||
| miRNA Stemloop AC | MI0000072 | ||||
| miRNA Stemloop ID | hsa-mir-18a | ||||
| Sequence | uaaggugcaucuagugcagauag | ||||
| TTD Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Successful Target | Target Info | [1] | |
| Glucocorticoid receptor (NR3C1) | Successful Target | Target Info | [2] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [3] | ||
| Osteoclast differentiation factor (ODF) | Successful Target | Target Info | [4] | ||
| Thyroid hormone receptor alpha (THRA) | Successful Target | Target Info | [4] | ||
| Mothers against decapentaplegic homolog 3 (SMAD3) | Successful Target | Target Info | [5] | ||
| ATM serine/threonine kinase (ATM) | Clinical trial Target | Target Info | [6] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [7] | ||
| DNA [cytosine-5]-methyltransferase 1 (DNMT1) | Clinical trial Target | Target Info | [8] | ||
| Apoptosis mediating surface antigen FAS (FAS) | Clinical trial Target | Target Info | [7] | ||
| Myosin light kinase (MYLK) | Clinical trial Target | Target Info | [9] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [10] | ||
| Connective tissue growth factor (CTGF) | Clinical trial Target | Target Info | [4] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [6] | ||
| Immunoglobulin gamma Fc receptor IIB (FCGR2B) | Clinical trial Target | Target Info | [11] | ||
| Thrombospondin-1 (THBS1) | Clinical trial Target | Target Info | [12] | ||
| Nuclear receptor coactivator 3 (NCOA3) | Literature-reported Target | Target Info | [13] | ||
| MST-1 protein kinase (STK4) | Literature-reported Target | Target Info | [14] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [15] | ||
| Pregnane X receptor (NR1I2) | Literature-reported Target | Target Info | [16] | ||
| Zinc finger protein A20 (TNFAIP3) | Literature-reported Target | Target Info | [17] | ||
| Enhancer of filamentation 1 (NEDD9) | Literature-reported Target | Target Info | [18] | ||
| Protein(s) Regulated by This miRNA | Bcl-2-like protein 10 | Regulated Protein | [19] | ||
| cAMP-responsive element-binding protein-like 2 | Regulated Protein | [9] | |||
| Cyclin-dependent kinase 19 | Regulated Protein | [18] | |||
| Cyclin-L1 | Regulated Protein | [4] | |||
| Cysteine/serine-rich nuclear protein 3 | Regulated Protein | [4] | |||
| E3 SUMO-protein ligase PIAS3 | Regulated Protein | [23] | |||
| Exophilin-5 | Regulated Protein | [9] | |||
| Heat shock factor protein 2 | Regulated Protein | [24] | |||
| Insulin-like growth factor 2 mRNA-binding protein 2 | Regulated Protein | [4] | |||
| Interferon regulatory factor 2 | Regulated Protein | [25] | |||
| Mothers against decapentaplegic homolog 2 | Regulated Protein | [26] | |||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [27] | |||
| Myocyte-specific enhancer factor 2D | Regulated Protein | [28] | |||
| Neogenin | Regulated Protein | [29] | |||
| PH domain leucine-rich repeat-containing protein phosphatase 1 | Regulated Protein | [30] | |||
| Runt-related transcription factor 1 | Regulated Protein | [31] | |||
| Syndecan-4 | Regulated Protein | [32] | |||
| TATA box-binding protein-like protein 1 | Regulated Protein | [33] | |||
| TSC22 domain family protein 3 | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47. | ||||
| REF 2 | MicroRNA 18 and 124a down-regulate the glucocorticoid receptor: implications for glucocorticoid responsiveness in the brain. Endocrinology. 2009 May;150(5):2220-8. | ||||
| REF 3 | Differential expression of miR-17~92 identifies BCL2 as a therapeutic target in BCR-ABL-positive B-lineage acute lymphoblastic leukemia. Leukemia. 2014 Mar;28(3):554-65. | ||||
| REF 4 | Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45. | ||||
| REF 5 | Targeting of TGF signature and its essential component CTGF by miR-18 correlates with improved survival in glioblastoma. RNA. 2013 Feb;19(2):177-90. | ||||
| REF 6 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 7 | Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63. | ||||
| REF 8 | Epigenetic regulation of miR-17~92 contributes to the pathogenesis of pulmonary fibrosis. Am J Respir Crit Care Med. 2013 Feb 15;187(4):397-405. | ||||
| REF 9 | MiR-17-92 cluster promotes hepatocarcinogenesis. Carcinogenesis. 2015 Oct;36(10):1213-22. | ||||
| REF 10 | miR-18a-5p Inhibits Sub-pleural Pulmonary Fibrosis by Targeting TGF- Receptor II. Mol Ther. 2017 Mar 1;25(3):728-738. | ||||
| REF 11 | The Myc-miR-17-92 axis amplifies B-cell receptor signaling via inhibition of ITIM proteins: a novel lymphomagenic feed-forward loop. Blood. 2013 Dec 19;122(26):4220-9. | ||||
| REF 12 | Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21. | ||||
| REF 13 | The estrogen receptor-alpha-induced microRNA signature regulates itself and its transcriptional response. Proc Natl Acad Sci U S A. 2009 Sep 15;106(37):15732-7. | ||||
| REF 14 | MicroRNA-18a is elevated in prostate cancer and promotes tumorigenesis through suppressing STK4 in vitro and in vivo. Oncogenesis. 2014 Apr 21;3:e99. | ||||
| REF 15 | miR-19 is a key oncogenic component of mir-17-92. Genes Dev. 2009 Dec 15;23(24):2839-49. | ||||
| REF 16 | Negative Regulation of Human Pregnane X Receptor by MicroRNA-18a-5p: Evidence for Suppression of MicroRNA-18a-5p Expression by Rifampin and Rilpivirine. Mol Pharmacol. 2017 Jul;92(1):48-56. | ||||
| REF 17 | Relevance of microRNA-18a and microRNA-199a-5p to hepatocellular carcinoma recurrence after living donor liver transplantation. Liver Transpl. 2016 May;22(5):665-76. | ||||
| REF 18 | Histone deacetylase inhibition in colorectal cancer cells reveals competing roles for members of the oncogenic miR-17-92 cluster. Mol Carcinog. 2013 Jun;52(6):459-74. | ||||
| REF 19 | Upregulation of miR-18a-5p contributes to epidermal necrolysis in severe drug eruptions.J Allergy Clin Immunol. 2014 Apr;133(4):1065-74. | ||||
| REF 20 | MiR-17-92 cluster promotes hepatocarcinogenesis. Carcinogenesis. 2015 Oct;36(10):1213-22. | ||||
| REF 21 | Histone deacetylase inhibition in colorectal cancer cells reveals competing roles for members of the oncogenic miR-17-92 cluster. Mol Carcinog. 2013 Jun;52(6):459-74. | ||||
| REF 22 | Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45. | ||||
| REF 23 | MicroRNA-18a modulates STAT3 activity through negative regulation of PIAS3 during gastric adenocarcinogenesis.Br J Cancer. 2013 Feb 19;108(3):653-61. | ||||
| REF 24 | miR-18, a member of Oncomir-1, targets heat shock transcription factor 2 in spermatogenesis.Development. 2010 Oct;137(19):3177-84. | ||||
| REF 25 | MicroRNA-18a modulates P53 expression by targeting IRF2 in gastric cancer patients.J Gastroenterol Hepatol. 2016 Jan;31(1):155-63. | ||||
| REF 26 | Variations of microRNAs in human placentas and plasma from preeclamptic pregnancy.Hypertension. 2014 Jun;63(6):1276-84. | ||||
| REF 27 | The myc-miR-17~92 axis blunts TGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenic factors. Cancer Res. 2010 Oct 15;70(20):8233-46. | ||||
| REF 28 | Overexpression of miR-18a negatively regulates myocyte enhancer factor 2D to increase the permeability of the blood-tumor barrier via Krpel-like factor 4-mediated downregulation of zonula occluden-1, claudin-5, and occludin.J Neurosci Res. 2015 Dec;93(12):1891-902. | ||||
| REF 29 | MiR-18a regulates the proliferation, migration and invasion of human glioblastoma cell by targeting neogenin.Exp Cell Res. 2014 May 15;324(1):54-64. | ||||
| REF 30 | The miRNA-17 2 cluster mediates chemoresistance and enhances tumor growth in mantle cell lymphoma via PI3K/AKT pathway activation.Leukemia. 2012 May;26(5):1064-72. | ||||
| REF 31 | MiR-18a increased the permeability of BTB via RUNX1 mediated down-regulation of ZO-1, occludin and claudin-5.Cell Signal. 2015 Jan;27(1):156-67. | ||||
| REF 32 | miR-18a-5p MicroRNA Increases Vascular Smooth Muscle Cell Differentiation by Downregulating Syndecan4.Korean Circ J. 2014 Jul;44(4):255-63. | ||||
| REF 33 | Tumor suppressor microRNA-18a regulates tumor proliferation and invasion by targeting TBPL1 in colorectal cancer cells.Mol Med Rep. 2015 Nov;12(5):7643-8. | ||||
| REF 34 | MicroRNA 18 and 124a down-regulate the glucocorticoid receptor: implications for glucocorticoid responsiveness in the brain. Endocrinology. 2009 May;150(5):2220-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.