miRNA General Information
miRNA Mature ID hsa-miR-195-3p
miRNA Stemloop AC MI0000489
miRNA Stemloop ID hsa-mir-195
Sequence ccaauauuggcugugcugcucc
TTD Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [1]
Fibroblast growth factor-2 (FGF2) Successful Target Target Info [2]
Protein(s) Regulated by This miRNA Cell adhesion molecule 2 Regulated Protein [1]
Clathrin heavy chain 1 Regulated Protein [1]
Cullin-2 Regulated Protein [1]
Desmocollin-3 Regulated Protein [1]
Mitofusin-2 Regulated Protein [4]
Polyadenylate-binding protein-interacting protein 2 Regulated Protein [1]
Probable bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase 2 Regulated Protein [1]
Ras-related protein Rab-6A Regulated Protein [1]
SUMO-conjugating enzyme UBC9 Regulated Protein [1]
References
REF 1 Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5). pii: E121.
REF 2 miR-195 Inhibits EMT by Targeting FGF2 in Prostate Cancer Cells. PLoS One. 2015 Dec 9;10(12):e0144073.
REF 3 Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5). pii: E121.
REF 4 MiR-195 dependent roles of mitofusin2 in the mitochondrial dysfunction of hippocampal neurons in SAMP8 mice.Brain Res. 2016 Dec 1;1652:135-143.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.