miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-195-3p | ||||
miRNA Stemloop AC | MI0000489 | ||||
miRNA Stemloop ID | hsa-mir-195 | ||||
Sequence | ccaauauuggcugugcugcucc | ||||
TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
Fibroblast growth factor-2 (FGF2) | Successful Target | Target Info | [2] | ||
Protein(s) Regulated by This miRNA | Cell adhesion molecule 2 | Regulated Protein | [1] | ||
Clathrin heavy chain 1 | Regulated Protein | [1] | |||
Cullin-2 | Regulated Protein | [1] | |||
Desmocollin-3 | Regulated Protein | [1] | |||
Mitofusin-2 | Regulated Protein | [4] | |||
Polyadenylate-binding protein-interacting protein 2 | Regulated Protein | [1] | |||
Probable bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase 2 | Regulated Protein | [1] | |||
Ras-related protein Rab-6A | Regulated Protein | [1] | |||
SUMO-conjugating enzyme UBC9 | Regulated Protein | [1] | |||
References | |||||
REF 1 | Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5). pii: E121. | ||||
REF 2 | miR-195 Inhibits EMT by Targeting FGF2 in Prostate Cancer Cells. PLoS One. 2015 Dec 9;10(12):e0144073. | ||||
REF 3 | Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5). pii: E121. | ||||
REF 4 | MiR-195 dependent roles of mitofusin2 in the mitochondrial dysfunction of hippocampal neurons in SAMP8 mice.Brain Res. 2016 Dec 1;1652:135-143. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.