miRNA General Information
miRNA Mature ID hsa-miR-198
miRNA Stemloop AC MI0000240
miRNA Stemloop ID hsa-mir-198
Sequence gguccagaggggagauagguuc
TTD Target(s) Regulated by This miRNA Fibroblast growth factor receptor 1 (FGFR1) Successful Target Target Info [1]
Janus kinase 3 (JAK-3) Successful Target Target Info [2]
NT-3 growth factor receptor (TrkC) Successful Target Target Info [3]
Proto-oncogene c-Met (MET) Successful Target Target Info [4]
Melanoma inhibitor of apoptosis protein (ML-IAP) Patented-recorded Target Target Info [5]
Protein(s) Regulated by This miRNA Cyclin-T1 Regulated Protein [6]
Follistatin-related protein 1 Regulated Protein [7]
G1/S-specific cyclin-D2 Regulated Protein [8]
Neuronatin Regulated Protein [9]
Pre-B-cell leukemia transcription factor 1 Regulated Protein [10]
References
REF 1 MicroRNA-198 inhibits proliferation and induces apoptosis of lung cancer cells via targeting FGFR1. J Cell Biochem. 2014 May;115(5):987-95.
REF 2 miR-29b and miR-198 overexpression in CD8+ T cells of renal cell carcinoma patients down-modulates JAK3 and MCL-1 leading to immune dysfunction. J Transl Med. 2016 Apr 11;14:84.
REF 3 Allele variants in functional MicroRNA target sites of the neurotrophin-3 receptor gene (NTRK3) as susceptibility factors for anxiety disorders. Hum Mutat. 2009 Jul;30(7):1062-71.
REF 4 miR-198 inhibits migration and invasion of hepatocellular carcinoma cells by targeting the HGF/c-MET pathway. FEBS Lett. 2011 Jul 21;585(14):2229-34.
REF 5 Livin expression may be regulated by miR-198 in human prostate cancer cell lines. Eur J Cancer. 2013 Feb;49(3):734-40.
REF 6 miR-198 inhibits HIV-1 gene expression and replication in monocytes and its mechanism of action appears to involve repression of cyclin T1.PLoS Pathog. 2009 Jan;5(1):e1000263.
REF 7 'See-saw' expression of microRNA-198 and FSTL1 from a single transcript in wound healing.Nature. 2013 Mar 7;495(7439):103-6.
REF 8 miR-198 Represses the Proliferation of HaCaT Cells by Targeting Cyclin D2.Int J Mol Sci. 2015 Jul 27;16(8):17018-28.
REF 9 Regulatory roles of miRNA in the human neural stem cell transformation to glioma stem cells.J Cell Biochem. 2014 Aug;115(8):1368-80.
REF 10 A tumorigenic factor interactome connected through tumor suppressor microRNA-198 in human pancreatic cancer.Clin Cancer Res. 2013 Nov 1;19(21):5901-13.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.