miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-198 | ||||
miRNA Stemloop AC | MI0000240 | ||||
miRNA Stemloop ID | hsa-mir-198 | ||||
Sequence | gguccagaggggagauagguuc | ||||
TTD Target(s) Regulated by This miRNA | Fibroblast growth factor receptor 1 (FGFR1) | Successful Target | Target Info | [1] | |
Janus kinase 3 (JAK-3) | Successful Target | Target Info | [2] | ||
NT-3 growth factor receptor (TrkC) | Successful Target | Target Info | [3] | ||
Proto-oncogene c-Met (MET) | Successful Target | Target Info | [4] | ||
Melanoma inhibitor of apoptosis protein (ML-IAP) | Patented-recorded Target | Target Info | [5] | ||
Protein(s) Regulated by This miRNA | Cyclin-T1 | Regulated Protein | [6] | ||
Follistatin-related protein 1 | Regulated Protein | [7] | |||
G1/S-specific cyclin-D2 | Regulated Protein | [8] | |||
Neuronatin | Regulated Protein | [9] | |||
Pre-B-cell leukemia transcription factor 1 | Regulated Protein | [10] | |||
References | |||||
REF 1 | MicroRNA-198 inhibits proliferation and induces apoptosis of lung cancer cells via targeting FGFR1. J Cell Biochem. 2014 May;115(5):987-95. | ||||
REF 2 | miR-29b and miR-198 overexpression in CD8+ T cells of renal cell carcinoma patients down-modulates JAK3 and MCL-1 leading to immune dysfunction. J Transl Med. 2016 Apr 11;14:84. | ||||
REF 3 | Allele variants in functional MicroRNA target sites of the neurotrophin-3 receptor gene (NTRK3) as susceptibility factors for anxiety disorders. Hum Mutat. 2009 Jul;30(7):1062-71. | ||||
REF 4 | miR-198 inhibits migration and invasion of hepatocellular carcinoma cells by targeting the HGF/c-MET pathway. FEBS Lett. 2011 Jul 21;585(14):2229-34. | ||||
REF 5 | Livin expression may be regulated by miR-198 in human prostate cancer cell lines. Eur J Cancer. 2013 Feb;49(3):734-40. | ||||
REF 6 | miR-198 inhibits HIV-1 gene expression and replication in monocytes and its mechanism of action appears to involve repression of cyclin T1.PLoS Pathog. 2009 Jan;5(1):e1000263. | ||||
REF 7 | 'See-saw' expression of microRNA-198 and FSTL1 from a single transcript in wound healing.Nature. 2013 Mar 7;495(7439):103-6. | ||||
REF 8 | miR-198 Represses the Proliferation of HaCaT Cells by Targeting Cyclin D2.Int J Mol Sci. 2015 Jul 27;16(8):17018-28. | ||||
REF 9 | Regulatory roles of miRNA in the human neural stem cell transformation to glioma stem cells.J Cell Biochem. 2014 Aug;115(8):1368-80. | ||||
REF 10 | A tumorigenic factor interactome connected through tumor suppressor microRNA-198 in human pancreatic cancer.Clin Cancer Res. 2013 Nov 1;19(21):5901-13. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.