miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-199a-3p | ||||
| miRNA Stemloop AC | MI0000242 | MI0000281 | ||||
| miRNA Stemloop ID | hsa-mir-199a-1 | hsa-mir-199a-2 | ||||
| Sequence | acaguagucugcacauugguua | ||||
| TTD Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Alpha-(1,3)-fucosyltransferase 4 | Regulated Protein | [2] | ||
| Caveolin-2 | Regulated Protein | [3] | |||
| Cyclin-L1 | Regulated Protein | [4] | |||
| DnaJ homolog subfamily A member 4 | Regulated Protein | [5] | |||
| Hepatocyte nuclear factor 3-beta | Regulated Protein | [6] | |||
| Integrin alpha-3 | Regulated Protein | [7] | |||
| Keratin, type II cytoskeletal 7 | Regulated Protein | [8] | |||
| Mediator of RNA polymerase II transcription subunit 6 | Regulated Protein | [4] | |||
| Probable global transcription activator SNF2L2 | Regulated Protein | [9] | |||
| Protein C-ets-2 | Regulated Protein | [4] | |||
| Serine/threonine-protein kinase STK11 | Regulated Protein | [10] | |||
| Suppressor of cytokine signaling 7 | Regulated Protein | [11] | |||
| Transcription factor A, mitochondrial | Regulated Protein | [12] | |||
| Transcription factor jun-B | Regulated Protein | [4] | |||
| Zinc fingers and homeoboxes protein 1 | Regulated Protein | [13] | |||
| References | |||||
| REF 1 | MiR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res. 2010 Jun 15;70(12):5184-93. | ||||
| REF 2 | The micro-RNA 199b-5p regulatory circuit involves Hes1, CD15, and epigenetic modifications in medulloblastoma.Neuro Oncol. 2012 May;14(5):596-612. | ||||
| REF 3 | MicroRNA miR-199a-3p regulates cell proliferation and survival by targeting caveolin-2.J Cell Sci. 2011 Aug 15;124(Pt 16):2826-36. | ||||
| REF 4 | Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45. | ||||
| REF 5 | Convergent multi-miRNA targeting of ApoE drives LRP1/LRP8-dependent melanoma metastasis and angiogenesis. Cell. 2012 Nov 21;151(5):1068-82. | ||||
| REF 6 | Transcriptomic and CRISPR/Cas9 technologies reveal FOXA2 as a tumor suppressor gene in pancreatic cancer.Am J Physiol Gastrointest Liver Physiol. 2016 Jun 1;310(11):G1124-37. | ||||
| REF 7 | Regulation of ITGA3 by the dual-stranded microRNA-199 family as a potential prognostic marker in bladder cancer.Br J Cancer. 2017 Apr 11;116(8):1077-1087. | ||||
| REF 8 | Identification of novel microRNA targets based on microRNA signatures in bladder cancer.Int J Cancer. 2009 Jul 15;125(2):345-52. | ||||
| REF 9 | MicroRNAs miR-199a-5p and -3p target the Brm subunit of SWI/SNF to generate a double-negative feedback loop in a variety of human cancers.Cancer Res. 2011 Mar 1;71(5):1680-9. | ||||
| REF 10 | Farnesoid X receptor protects hepatocytes from injury by repressing miR-199a-3p, which increases levels of LKB1.Gastroenterology. 2012 May;142(5):1206-1217.e7. | ||||
| REF 11 | p53 induces miR199a-3p to suppress SOCS7 for STAT3 activation and renal fibrosis in UUO.Sci Rep. 2017 Feb 27;7:43409. | ||||
| REF 12 | MiR-199a-3p enhances breast cancer cell sensitivity to cisplatin by downregulating TFAM (TFAM).Biomed Pharmacother. 2017 Apr;88:507-514. | ||||
| REF 13 | MiR-199a-3p promotes gastric cancer progression by targeting ZHX1.FEBS Lett. 2014 Nov 28;588(23):4504-12. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.