miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-23b-5p | ||||
| miRNA Stemloop AC | MI0000439 | ||||
| miRNA Stemloop ID | hsa-mir-23b | ||||
| Sequence | uggguuccuggcaugcugauuu | ||||
| TTD Target(s) Regulated by This miRNA | Mothers against decapentaplegic homolog 3 (SMAD3) | Successful Target | Target Info | [1] | |
| Transforming growth factor beta 2 (TGFB2) | Clinical trial Target | Target Info | [2] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Proline dehydrogenase 1, mitochondrial | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | MicroRNA-23b Inhibits the Proliferation and Migration of Heat-Denatured Fibroblasts by Targeting Smad3. PLoS One. 2015 Jul 8;10(7):e0131867. | ||||
| REF 2 | Umbilical Cord-Derived Mesenchymal Stem Cell-Derived Exosomal MicroRNAs Suppress Myofibroblast Differentiation by Inhibiting the Transforming Growth Factor-/SMAD2 Pathway During Wound Healing. Stem Cells Transl Med. 2016 Oct;5(10):1425-1439. | ||||
| REF 3 | miR-23b targets proline oxidase, a novel tumor suppressor protein in renal cancer.Oncogene. 2010 Sep 2;29(35):4914-24. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.