miRNA General Information
miRNA Mature ID hsa-miR-31-3p
miRNA Stemloop AC MI0000089
miRNA Stemloop ID hsa-mir-31
Sequence ugcuaugccaacauauugccau
TTD Target(s) Regulated by This miRNA Nectin cell adhesion molecule 4 (NECTIN4) Successful Target Target Info [1]
Transforming protein RhoA (RHOA) Discontinued Target Target Info [2]
Transcription factor E2F2 (E2F2) Literature-reported Target Target Info [3]
Protein(s) Regulated by This miRNA Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial Regulated Protein [4]
References
REF 1 MiR-31 and miR-128 regulates poliovirus receptor-related 4 mediated measles virus infectivity in tumors. Mol Oncol. 2016 Nov;10(9):1387-1403.
REF 2 Passenger strand miRNA miR-31* regulates the phenotypes of oral cancer cells by targeting RhoA. Oral Oncol. 2013 Jan;49(1):27-33.
REF 3 miR-31 and miR-17-5p levels change during transformation of follicular lymphoma. Hum Pathol. 2016 Apr;50:118-26.
REF 4 MiR-31/SDHA Axis Regulates Reprogramming Efficiency through Mitochondrial Metabolism.Stem Cell Reports. 2016 Jul 12;7(1):1-10.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.