miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-31-3p | ||||
miRNA Stemloop AC | MI0000089 | ||||
miRNA Stemloop ID | hsa-mir-31 | ||||
Sequence | ugcuaugccaacauauugccau | ||||
TTD Target(s) Regulated by This miRNA | Nectin cell adhesion molecule 4 (NECTIN4) | Successful Target | Target Info | [1] | |
Transforming protein RhoA (RHOA) | Discontinued Target | Target Info | [2] | ||
Transcription factor E2F2 (E2F2) | Literature-reported Target | Target Info | [3] | ||
Protein(s) Regulated by This miRNA | Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial | Regulated Protein | [4] | ||
References | |||||
REF 1 | MiR-31 and miR-128 regulates poliovirus receptor-related 4 mediated measles virus infectivity in tumors. Mol Oncol. 2016 Nov;10(9):1387-1403. | ||||
REF 2 | Passenger strand miRNA miR-31* regulates the phenotypes of oral cancer cells by targeting RhoA. Oral Oncol. 2013 Jan;49(1):27-33. | ||||
REF 3 | miR-31 and miR-17-5p levels change during transformation of follicular lymphoma. Hum Pathol. 2016 Apr;50:118-26. | ||||
REF 4 | MiR-31/SDHA Axis Regulates Reprogramming Efficiency through Mitochondrial Metabolism.Stem Cell Reports. 2016 Jul 12;7(1):1-10. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.