miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-340-3p | ||||
miRNA Stemloop AC | MI0000802 | ||||
miRNA Stemloop ID | hsa-mir-340 | ||||
Sequence | uccgucucaguuacuuuauagc | ||||
TTD Target(s) Regulated by This miRNA | Enhancer of zeste homolog 2 (EZH2) | Successful Target | Target Info | [1] | |
References | |||||
REF 1 | MiR-340 impedes the progression of laryngeal squamous cell carcinoma by targeting EZH2. Gene. 2016 Feb 15;577(2):193-201. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.