miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-497-3p | ||||
miRNA Stemloop AC | MI0003138 | ||||
miRNA Stemloop ID | hsa-mir-497 | ||||
Sequence | caaaccacacugugguguuaga | ||||
TTD Target(s) Regulated by This miRNA | Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [1] | |
Protein(s) Regulated by This miRNA | Zinc finger protein SNAI2 | Regulated Protein | [2] | ||
References | |||||
REF 1 | miR-497 suppresses angiogenesis in breast carcinoma by targeting HIF-1. Oncol Rep. 2016 Mar;35(3):1696-702. | ||||
REF 2 | miR-497 inhibits epithelial mesenchymal transition in breast carcinoma by targeting Slug.Tumour Biol. 2016 Jun;37(6):7939-50. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.