miRNA General Information
miRNA Mature ID	hsa-miR-501-5p
miRNA Stemloop AC	MI0003185
miRNA Stemloop ID	hsa-mir-501
Sequence	aauccuuugucccugggugaga
TTD Target(s) Regulated by This miRNA	Glycogen synthase kinase-3 beta (GSK-3B)	Clinical trial Target	Target Info	[1]
	Dickkopf-related protein 1 (DKK1)	Clinical trial Target	Target Info	[1]
Protein(s) Regulated by This miRNA	Protein naked cuticle homolog 1	Regulated Protein	NKD1_HUMAN	[1]
	Ragulator complex protein LAMTOR5	Regulated Protein	LTOR5_HUMAN	[3]
References
REF 1	Upregulation of miR-501-5p activates the wnt/-catenin signaling pathway and enhances stem cell-like phenotype in gastric cancer. J Exp Clin Cancer Res. 2016 Nov 15;35(1):177.
REF 2	Upregulation of miR-501-5p activates the wnt/-catenin signaling pathway and enhances stem cell-like phenotype in gastric cancer. J Exp Clin Cancer Res. 2016 Nov 15;35(1):177.
REF 3	MicroRNA-501 promotes HBV replication by targeting HBXIP.Biochem Biophys Res Commun. 2013 Jan 25;430(4):1228-33.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.