miRNA General Information
miRNA Mature ID hsa-miR-502-5p
miRNA Stemloop AC MI0003186
miRNA Stemloop ID hsa-mir-502
Sequence auccuugcuaucugggugcua
TTD Target(s) Regulated by This miRNA SET domain containing 8 (KMT5A) Preclinical Target Target Info [1]
Interferon regulatory factor 1 (IRF1) Literature-reported Target Target Info [2]
Protein(s) Regulated by This miRNA Interferon alpha-inducible protein 27, mitochondrial Regulated Protein [3]
Ras-related protein Rab-1B Regulated Protein [4]
TNF receptor-associated factor 2 Regulated Protein [5]
References
REF 1 An miR-502-binding site single-nucleotide polymorphism in the 3'-untranslated region of the SET8 gene is associated with early age of breast cancer... Clin Cancer Res. 2009 Oct 1;15(19):6292-300.
REF 2 Rs56288038 (C/G) in 3'UTR of IRF-1 Regulated by MiR-502-5p Promotes Gastric Cancer Development. Cell Physiol Biochem. 2016;40(1-2):391-399.
REF 3 Interferon alpha-inducible protein 27 promotes epithelial-mesenchymal transition and induces ovarian tumorigenicity and stemness.J Surg Res. 2015 Jan;193(1):255-64.
REF 4 Inhibition of autophagy and tumor growth in colon cancer by miR-502.Oncogene. 2013 Mar 21;32(12):1570-9.
REF 5 Suppressive role of miR-502-5p in breast cancer via downregulation of TRAF2.Oncol Rep. 2014 May;31(5):2085-92.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.