miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-502-5p | ||||
miRNA Stemloop AC | MI0003186 | ||||
miRNA Stemloop ID | hsa-mir-502 | ||||
Sequence | auccuugcuaucugggugcua | ||||
TTD Target(s) Regulated by This miRNA | SET domain containing 8 (KMT5A) | Preclinical Target | Target Info | [1] | |
Interferon regulatory factor 1 (IRF1) | Literature-reported Target | Target Info | [2] | ||
Protein(s) Regulated by This miRNA | Interferon alpha-inducible protein 27, mitochondrial | Regulated Protein | [3] | ||
Ras-related protein Rab-1B | Regulated Protein | [4] | |||
TNF receptor-associated factor 2 | Regulated Protein | [5] | |||
References | |||||
REF 1 | An miR-502-binding site single-nucleotide polymorphism in the 3'-untranslated region of the SET8 gene is associated with early age of breast cancer... Clin Cancer Res. 2009 Oct 1;15(19):6292-300. | ||||
REF 2 | Rs56288038 (C/G) in 3'UTR of IRF-1 Regulated by MiR-502-5p Promotes Gastric Cancer Development. Cell Physiol Biochem. 2016;40(1-2):391-399. | ||||
REF 3 | Interferon alpha-inducible protein 27 promotes epithelial-mesenchymal transition and induces ovarian tumorigenicity and stemness.J Surg Res. 2015 Jan;193(1):255-64. | ||||
REF 4 | Inhibition of autophagy and tumor growth in colon cancer by miR-502.Oncogene. 2013 Mar 21;32(12):1570-9. | ||||
REF 5 | Suppressive role of miR-502-5p in breast cancer via downregulation of TRAF2.Oncol Rep. 2014 May;31(5):2085-92. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.