miRNA General Information
miRNA Mature ID	hsa-miR-584-5p
miRNA Stemloop AC	MI0003591
miRNA Stemloop ID	hsa-mir-584
Sequence	uuaugguuugccugggacugag
TTD Target(s) Regulated by This miRNA	Rho-associated protein kinase 1 (ROCK1)	Successful Target	Target Info	[1]
References
REF 1	Tumour suppressor microRNA-584 directly targets oncogene Rock-1 and decreases invasion ability in human clear cell renal cell carcinoma. Br J Cancer. 2011 Jan 18;104(2):308-15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.