miRNA General Information
miRNA Mature ID	hsa-miR-588
miRNA Stemloop AC	MI0003597
miRNA Stemloop ID	hsa-mir-588
Sequence	uuggccacaauggguuagaac
TTD Target(s) Regulated by This miRNA	Granulin (GRN)	Literature-reported Target	Target Info	[1]
References
REF 1	MicroRNA-588 suppresses tumor cell migration and invasion by targeting GRN in lung squamous cell carcinoma. Mol Med Rep. 2016 Oct;14(4):3021-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.