miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-590-5p | ||||
| miRNA Stemloop AC | MI0003602 | ||||
| miRNA Stemloop ID | hsa-mir-590 | ||||
| Sequence | gagcuuauucauaaaagugcag | ||||
| TTD Target(s) Regulated by This miRNA | Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [1] | |
| Mothers against decapentaplegic homolog 3 (SMAD3) | Successful Target | Target Info | [2] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [3] | ||
| Lectin-like oxidized LDL receptor (OLR1) | Clinical trial Target | Target Info | [4] | ||
| Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) | Literature-reported Target | Target Info | [5] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [6] | ||
| Protein(s) Regulated by This miRNA | Cyclic AMP-responsive element-binding protein 5 | Regulated Protein | [7] | ||
| Interleukin enhancer-binding factor 3 | Regulated Protein | [8] | |||
| Neural cell adhesion molecule L1-like protein | Regulated Protein | [9] | |||
| Protein BTG2 | Regulated Protein | [10] | |||
| Retinoblastoma-associated protein | Regulated Protein | [11] | |||
| References | |||||
| REF 1 | miRNA expression profile of vulvar squamous cell carcinoma and identification of the oncogenic role of miR-590-5p. Oncol Rep. 2016 Jan;35(1):398-408. | ||||
| REF 2 | Hsa-miR-590-5p Interaction with SMAD3 Transcript Supports Its Regulatory Effect on The TGF Signaling Pathway. Cell J. 2016 Spring;18(1):7-12. | ||||
| REF 3 | Downregulation of miR-133 and miR-590 contributes to nicotine-induced atrial remodelling in canines. Cardiovasc Res. 2009 Aug 1;83(3):465-72. | ||||
| REF 4 | MicroRNA-155 silencing enhances inflammatory response and lipid uptake in oxidized low-density lipoprotein-stimulated human THP-1 macrophages. J Investig Med. 2010 Dec;58(8):961-7. | ||||
| REF 5 | A feedback expression of microRNA-590 and activating transcription factor-3 in human breast cancer cells. Int J Biol Macromol. 2015 Jan;72:145-50. | ||||
| REF 6 | miR-590-5p regulates gastric cancer cell growth and chemosensitivity through RECK and the AKT/ERK pathway. Onco Targets Ther. 2016 Oct 3;9:6009-6019. | ||||
| REF 7 | MiR-582-5p/miR-590-5p targeted CREB1/CREB5-NF-B signaling and caused opioid-induced immunosuppression in human monocytes. Transl Psychiatry. 2016 Mar 15;6:e757. | ||||
| REF 8 | MiR-590-5p inhibits colorectal cancer angiogenesis and metastasis by regulating nuclear factor 90/vascular endothelial growth factor A axis.Cell Death Dis. 2016 Oct 13;7(10):e2413. | ||||
| REF 9 | MicroRNA-590 promotes cervical cancer cell growth and invasion by targeting CHL1.J Cell Biochem. 2014 May;115(5):847-53. | ||||
| REF 10 | SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes.Nat Commun. 2015 Sep 23;6:8257. | ||||
| REF 11 | miR-590 promotes cell proliferation and invasion in T-cell acute lymphoblastic leukaemia by inhibiting RB1.Oncotarget. 2016 Jun 28;7(26):39527-39534. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.