miRNA General Information
miRNA Mature ID	hsa-miR-641
miRNA Stemloop AC	MI0003656
miRNA Stemloop ID	hsa-mir-641
Sequence	aaagacauaggauagagucaccuc
TTD Target(s) Regulated by This miRNA	Synaptosomal-associated protein 25 (SNAP25)	Successful Target	Target Info	[1]
References
REF 1	Association of impulsivity and polymorphic microRNA-641 target sites in the SNAP-25 gene. PLoS One. 2013 Dec 31;8(12):e84207.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.