miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-92b-3p | ||||
| miRNA Stemloop AC | MI0003560 | ||||
| miRNA Stemloop ID | hsa-mir-92b | ||||
| Sequence | uauugcacucgucccggccucc | ||||
| TTD Target(s) Regulated by This miRNA | Mothers against decapentaplegic homolog 3 (SMAD3) | Successful Target | Target Info | [1] | |
| Integrin alpha-V (ITGAV) | Clinical trial Target | Target Info | [2] | ||
| Protein arginine methyltransferase 5 (PRMT5) | Clinical trial Target | Target Info | [3] | ||
| Dickkopf-related protein 3 (DKK3) | Clinical trial Target | Target Info | [4] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [5] | ||
| Integrin alpha-6 (ITGA6) | Literature-reported Target | Target Info | [6] | ||
| Solute carrier family 15 member 1 (SLC15A1) | Literature-reported Target | Target Info | [7] | ||
| CDK inhibitor 1C p57Kip2 (CDKN1C) | Literature-reported Target | Target Info | [8] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [9] | ||
| Protein(s) Regulated by This miRNA | Disabled homolog 2-interacting protein | Regulated Protein | [10] | ||
| Ras-related protein Rab-23 | Regulated Protein | [11] | |||
| Serine/threonine-protein kinase NLK | Regulated Protein | [12] | |||
| References | |||||
| REF 1 | The miR-92b functions as a potential oncogene by targeting on Smad3 in glioblastomas. Brain Res. 2013 Sep 5;1529:16-25. | ||||
| REF 2 | MicroRNA-92b represses invasion-metastasis cascade of esophageal squamous cell carcinoma. Oncotarget. 2016 Apr 12;7(15):20209-22. | ||||
| REF 3 | Protein arginine methyltransferase 5 suppresses the transcription of the RB family of tumor suppressors in leukemia and lymphoma cells. Mol Cell Biol. 2008 Oct;28(20):6262-77. | ||||
| REF 4 | MiR-92b inhibitor promoted glioma cell apoptosis via targeting DKK3 and blocking the Wnt/beta-catenin signaling pathway. J Transl Med. 2013 Dec 11;11:302. | ||||
| REF 5 | EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21. | ||||
| REF 6 | Integrin 6 promotes esophageal cancer metastasis and is targeted by miR-92b. Oncotarget. 2017 Jan 24;8(4):6681-6690. | ||||
| REF 7 | MicroRNA-92b regulates expression of the oligopeptide transporter PepT1 in intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol. 2011 Jan;300(1):G52-9. | ||||
| REF 8 | MicroRNAs 221 and 222 bypass quiescence and compromise cell survival. Cancer Res. 2008 Apr 15;68(8):2773-80. | ||||
| REF 9 | Inhibition of miR-92b suppresses nonsmall cell lung cancer cells growth and motility by targeting RECK. Mol Cell Biochem. 2014 Feb;387(1-2):171-6. | ||||
| REF 10 | miR-92b targets DAB2IP to promote EMT in bladder cancer migration and invasion.Oncol Rep. 2016 Sep;36(3):1693-701. | ||||
| REF 11 | RAB23, regulated by miR-92b, promotes the progression of esophageal squamous cell carcinoma.Gene. 2016 Dec 20;595(1):31-38. | ||||
| REF 12 | miR-92b controls glioma proliferation and invasion through regulating Wnt/beta-catenin signaling via Nemo-like kinase.Neuro Oncol. 2013 May;15(5):578-88. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.