Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T03661 Target Info
Target Name Adenosine deaminase (ADA)
Synonyms Adenosine aminohydrolase; ADA1
Target Type Successful Target
Gene Name ADA
Biochemical Class Carbon-nitrogen hydrolase
UniProt ID
P00813
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-140-5p miRNA Info
miRNA Mature AC
MIMAT0000431
Sequence cagugguuuuacccuaugguag
miRNA Species Homo sapiens
Regulation Mechanism miR-140-5p could directly targets ADAM10 in TSCC cells and represses cell migration and invasion, but not proliferation. The repressed ADAM10 also helps to enhance the effect of miR-140-5p to other target genes. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Adenosine deaminase (ADA) Target Info
ADA_HUMAN
Aspartyl aminopeptidase (DNPEP) Target Info
DNPEP_HUMAN
References  Top
REF 1 Reciprocal effects between microRNA-140-5p and ADAM10 suppress migration and invasion of human tongue cancer cells. Biochem Biophys Res Commun. 2014 Jun 6;448(3):308-14.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.