Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T06869 Target Info
Target Name Platelet-derived growth factor A (PDGFA)
Synonyms Platelet-derived growth factor subunit A; Platelet-derived growth factor alpha polypeptide; Platelet-derived growth factor A chain; Platelet derived growth factor; PDGF1; PDGF-1; PDGF subunit A; PDGF; C-SIS oncogene
Target Type Clinical trial Target
Gene Name PDGFA
Biochemical Class Growth factor
UniProt ID
P04085
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7d-5p miRNA Info
miRNA Mature AC
MIMAT0000065
Sequence agagguaguagguugcauaguu
miRNA Species Homo sapiens
Regulation Mechanism Let-7d is specifically induced by PDGFA. [1]
Evidence Score (E-score) 1 +
1 ELISA; Immunoblot [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Divalent metal transporter 1 (SLC11A2) Target Info
NRAM2_HUMAN
References  Top
REF 1 PDGF induced microRNA alterations in cancer cells. Nucleic Acids Res. 2011 May;39(10):4035-47.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.