Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T10091 Target Info
Target Name Rhodopsin (RHO)
Synonyms Opsin-2; OPN2
Target Type Literature-reported Target
Gene Name RHO
Biochemical Class GPCR rhodopsin
UniProt ID
P08100
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
References  Top
REF 1 Targeting miR-21 inhibits in vitro and in vivo multiple myeloma cell growth. Clin Cancer Res. 2013 Apr 15;19(8):2096-106.
REF 2 Overexpression of miR-21 in patients with ulcerative colitis impairs intestinal epithelial barrier function through targeting the Rho GTPase RhoB. Biochem Biophys Res Commun. 2013 May 17;434(4):746-52.
REF 3 Brain endothelial miR-146a negatively modulates T-cell adhesion through repressing multiple targets to inhibit NF-B activation. J Cereb Blood Flow Metab. 2015 Mar;35(3):412-23.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.