Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T11203 |
Target Info
|
Target Name |
Vitiligo-associated protein 1 (FBXO11) |
Synonyms |
Vitiligoassociated protein 1; VIT1; VIT-1; UG063H01; Protein arginine N-methyltransferase 9; PRMT9; Fbox only protein 11; FBX11; F-box only protein 11 |
Target Type |
Literature-reported Target |
Gene Name |
FBXO11 |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcuuaucagacugauguuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
By binding to the 3-UTR of target FBXO11, miR-21 targets mRNAs for degradation. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Microarray |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-543 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaacauucgcggugcacuucuu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Focal adhesion kinase 1 (FAK)
|
Target Info
|
|
High mobility group protein HMGI-C (HMGA2)
|
Target Info
|
|
References |
Top |
REF 1 |
The oncogenic microRNA-21 inhibits the tumor suppressive activity of FBXO11 to promote tumorigenesis. J Biol Chem. 2015 Mar 6;290(10):6037-46.
|
REF 2 |
MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
|
REF 3 |
MiRNA-543 promotes osteosarcoma cell proliferation and glycolysis by partially suppressing PRMT9 and stabilizing HIF-1 protein. Oncotarget. 2017 Jan 10;8(2):2342-2355.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.