The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-130a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cagugcaauguuaaaagggcau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR |
[1] |
2 |
PAR-CLIP |
[2] |
Representative Target(s) Regulated by This miRNA |
Activin receptor-like kinase 2 (ALK-2)
|
Target Info
|
|
Amyloid beta A4 protein (APP)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-148a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucagugcacuacagaacuuugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
A receptor type 1 (ACVR1) expression was significantly negatively correlated with miR-148a and was significantly differentially expressed. |
[3] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
2 |
Luciferase Reporter Assay |
[4] |
Representative Target(s) Regulated by This miRNA |
Activated leukocyte cell adhesionmolecule (ALCAM)
|
Target Info
|
|
Activin receptor-like kinase 2 (ALK-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-let-7b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaguagguugugugguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[5] |
Representative Target(s) Regulated by This miRNA |
Activin receptor-like kinase 2 (ALK-2)
|
Target Info
|
|
CDK inhibitor 1B p27Kip1 (CDKN1B)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-148b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucagugcaucacagaacuuugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-148b induced a downregulation of ACVR1 mRNA expression in U2OS and HeLa cells. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[6] |
Representative Target(s) Regulated by This miRNA |
Activated leukocyte cell adhesionmolecule (ALCAM)
|
Target Info
|
|
Activin receptor-like kinase 2 (ALK-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-365a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaugccccuaaaaauccuuau
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
mir365 induced a downregulation of ACVR1 mRNA expression in U2OS and HeLa cells. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[6] |
Representative Target(s) Regulated by This miRNA |
Activin receptor-like kinase 2 (ALK-2)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-197-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucaccaccuucuccacccagc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Overexpression of miR-197 leads to reduced mRNA levels of ACVR1. |
[7] |
Evidence Score (E-score) |
1 |
+ |
1 |
Microarray |
[7] |
Representative Target(s) Regulated by This miRNA |
Activin receptor-like kinase 2 (ALK-2)
|
Target Info
|
|
Extracellular signal-regulated kinase 2 (ERK2)
|
Target Info
|
|