Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T12837 |
Target Info
|
Target Name |
Histone-arginine methyltransferase CARM1 (CARM1) |
Synonyms |
Protein arginine N-methyltransferase 4; PRMT4; Histonearginine methyltransferase CARM1; Coactivatorassociated arginine methyltransferase 1; Coactivator-associated arginine methyltransferase 1 |
Target Type |
Literature-reported Target |
Gene Name |
CARM1 |
Biochemical Class |
Methyltransferase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-223-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugucaguuugucaaauacccca
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
RT-PCR; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
ATM serine/threonine kinase (ATM)
|
Target Info
|
|
C-X-C motif chemokine 2 (CXCL2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-15a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcacauaaugguuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
CARM1 targeted by miR-15a played an important role in chemokine activation in the pathogenesis of acute coronary syndrome. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
References |
Top |
REF 1 |
PRMT4 blocks myeloid differentiation by assembling a methyl-RUNX1-dependent repressor complex. Cell Rep. 2013 Dec 26;5(6):1625-38.
|
REF 2 |
A multi-omics analysis of the regulatory changes induced by miR-223 in a monocyte/macrophage cell line. Biochim Biophys Acta Mol Basis Dis. 2018 Aug;1864(8):2664-2678.
|
REF 3 |
Coactivator-associated arginine methyltransferase 1 targeted by miR-15a regulates inflammation in acute coronary syndrome. Atherosclerosis. 2014 Apr;233(2):349-56.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.