Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T14231 |
Target Info
|
| Target Name |
Leucine-rich repeat-containing GPCR 5 (LGR5) |
| Synonyms |
Orphan G protein-coupled receptor HG38; Leucine-rich repeat-containing G-protein coupled receptor 5; Gpr49; GPR67; G-protein coupled receptor HG38; G-protein coupled receptor 67; G-protein coupled receptor 49; G protein-coupled receptor 49 |
| Target Type |
Clinical trial Target |
| Gene Name |
LGR5 |
| Biochemical Class |
GPCR rhodopsin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-142-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uguaguguuuccuacuuuaugga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-142-3p mimics significantly reduced the luciferase activity of the LGR5. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
|
High mobility group protein B1 (HMGB1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-142-3p functions as a tumor suppressor by targeting CD133, ABCG2, and Lgr5 in colon cancer cells. J Mol Med (Berl). 2013 Aug;91(8):989-1000.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
