Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T14875 |
Target Info
|
| Target Name |
Ubiquitin carboxyl-terminal hydrolase 14 (USP14) |
| Synonyms |
Ubiquitin-specific-processing protease 14; Ubiquitin thioesterase 14; TGT; Deubiquitinating enzyme 14 |
| Target Type |
Preclinical Target |
| Gene Name |
USP14 |
| Biochemical Class |
Peptidase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-4782-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugauugucuucauaucuagaac
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-4782-3p inhibited cell proliferation in NSCLC by targeting USP14. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Ubiquitin carboxyl-terminal hydrolase 14 (USP14)
|
Target Info
|
|
|
X-linked inhibitor of apoptosis protein (XIAP)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The tumor suppressor role of miR-4782-3p in hepatocellular carcinoma. Oncol Rep. 2016 Apr;35(4):2107-12.
|
| REF 2 |
MiR-4782-3p inhibited non-small cell lung cancer growth via USP14. Cell Physiol Biochem. 2014;33(2):457-67.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
