Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T15023 Target Info
Target Name Neuropilin-1 (NRP1)
Synonyms Vascular endothelial cell growth factor 165 receptor; VEGF165R; Platelet-derived endothelial cell growth factor receptor; NRP; Membrane-bound; CD304
Target Type Successful Target
Gene Name NRP1
Biochemical Class Neuropilin and tolloid-like
UniProt ID
O14786
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [1]
2 Western Blot; RT-PCR [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism miR-152 targeted the 3'UTR of neuropilin-1 mRNA to inhibit its translation. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Microarray Assay [4]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism miR-206 inhibits NRP1 gene expression by directly binding to its 3'UTR. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-338-3p miRNA Info
miRNA Mature AC
MIMAT0000763
Sequence uccagcaucagugauuuuguug
miRNA Species Homo sapiens
Regulation Mechanism miR-338 can decrease migratory, invasive, proliferative and apoptotic behaviors, as well as gastric cancer EMT, by attenuating the expression of NRP1. [6]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-338-5p miRNA Info
miRNA Mature AC
MIMAT0004701
Sequence aacaauauccuggugcugagug
miRNA Species Homo sapiens
Regulation Mechanism miR-338 inhibits growth and metastasis of OSCC cells by targeting NRP1. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA LDL receptor related protein-1 (LRP-1) Target Info
LRP1_HUMAN
Lysophosphatidic acid receptor 1 (LPAR1) Target Info
LPAR1_HUMAN
References  Top
REF 1 MiR-148a, a microRNA upregulated in the WNT subgroup tumors, inhibits invasion and tumorigenic potential of medulloblastoma cells by targeting Neur... Oncoscience. 2015 Mar 2;2(4):334-48.
REF 2 MiR-148a functions to suppress metastasis and serves as a prognostic indicator in triple-negative breast cancer. Oncotarget. 2016 Apr 12;7(15):20381-94.
REF 3 MiR-152 regulates metastases of non-small cell lung cancer cells by targeting neuropilin-1. Int J Clin Exp Pathol. 2015 Nov 1;8(11):14235-40.
REF 4 Integrated analysis of mRNA and microRNA expression in mature neurons, neural progenitor cells and neuroblastoma cells. Gene. 2012 Mar 10;495(2):120-7.
REF 5 MiR-206 suppresses epithelial mesenchymal transition by targeting TGF- signaling in estrogen receptor positive breast cancer cells. Oncotarget. 2016 Apr 26;7(17):24537-48.
REF 6 MicroRNA-338 inhibits growth, invasion and metastasis of gastric cancer by targeting NRP1 expression. PLoS One. 2014 Apr 15;9(4):e94422.
REF 7 MiR-338 suppresses the growth and metastasis of OSCC cells by targeting NRP1. Mol Cell Biochem. 2015 Jan;398(1-2):115-22.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.