Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T15700 Target Info
Target Name Caspase-8 (CASP8)
Synonyms MORT1-associated CED-3 homolog; MCH5; MACH; ICE-like apoptotic protease 5; FLICE; FADD-like ICE; FADD-homologous ICE/CED-3-like protease; CASP-8; CAP4; Apoptotic protease Mch-5; Apoptotic cysteine protease
Target Type Patented-recorded Target
Gene Name CASP8
Biochemical Class Peptidase
UniProt ID
Q14790
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism CASP8 is a direct target of miR-21. [1]
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Luciferase Reporter Assay; Northern Blot; Western Blot [1]
2 Western Blot; Immunoblot; RT-PCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism CASP8 served as the functional target of miR-106b-5p. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-19b-1-5p miRNA Info
miRNA Mature AC
MIMAT0004491
Sequence aguuuugcagguuugcauccagc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Caspase-8 (CASP8) Target Info
CASP8_HUMAN
Fibroblast growth factor receptor 2 (FGFR2) Target Info
FGFR2_HUMAN
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
References  Top
REF 1 A set of NF-B-regulated microRNAs induces acquired TRAIL resistance in lung cancer. Proc Natl Acad Sci U S A. 2015 Jun 30;112(26):E3355-64.
REF 2 MicroRNA-21 attenuates renal ischemia reperfusion injury via targeting caspase signaling in mice. Am J Nephrol. 2014;40(3):215-23.
REF 3 MicroRNA-106b-5p boosts glioma tumorigensis by targeting multiple tumor suppressor genes. Oncogene. 2014 Oct 2;33(40):4813-22.
REF 4 MiR-19b-1 inhibits angiogenesis by blocking cell cycle progression of endothelial cells. Biochem Biophys Res Commun. 2012 Jan 13;417(2):771-6.
REF 5 MicroRNA-296-5p Promotes Invasiveness through Downregulation of Nerve Growth Factor Receptor and Caspase-8. Mol Cells. 2017 Apr;40(4):254-261.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.