Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T16243 |
Target Info
|
| Target Name |
Beta-arrestin-2 (ARRB2) |
| Synonyms |
Non-visual arrestin-3; Betaarrestin2; Arrestin beta2; Arrestin beta-2; ARR2; ARB2 |
| Target Type |
Literature-reported Target |
| Gene Name |
ARRB2 |
| Biochemical Class |
Arrestin protein |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-150-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucucccaacccuuguaccagug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
ARRB2 is downregulated by miR-150 in human CD4+T lymphocytes. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
|
Beta-arrestin-2 (ARRB2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-150 impairs inflammatory cytokine production by targeting ARRB-2 after blocking CD28/B7 costimulatory pathway. Immunol Lett. 2016 Apr;172:1-10.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
