Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T16514 |
Target Info
|
| Target Name |
Fatty acid synthase (FASN) |
| Synonyms |
Yeast fatty acid synthase; Fatty-acyl-CoA synthase; Fatty acyl-CoA synthetase enzyme; FAS |
| Target Type |
Successful Target |
| Gene Name |
FASN |
| Biochemical Class |
Acyltransferase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-195-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcagcacagaaauauuggc
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
PAR-CLIP |
[2] |
| Representative Target(s) Regulated by This miRNA |
ADP-ribosylation factor-like protein 2 (ARL2)
|
Target Info
|
|
|
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-424-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cagcagcaauucauguuuugaa
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| 2 |
PAR-CLIP |
[2] |
| Representative Target(s) Regulated by This miRNA |
Checkpoint kinase-1 (CHK1)
|
Target Info
|
|
|
Cyclin D (CCND3)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-532-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
caugccuugaguguaggaccgu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR; Western Blot |
[4] |
| Representative Target(s) Regulated by This miRNA |
C-X-C motif chemokine 2 (CXCL2)
|
Target Info
|
|
|
Fatty acid synthase (FASN)
|
Target Info
|
|
| References |
Top |
| REF 1 |
microRNA-195 suppresses osteosarcoma cell invasion and migration in vitro by targeting FASN. Oncol Lett. 2012 Nov;4(5):1125-1129.
|
| REF 2 |
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
|
| REF 3 |
Tumor suppressive microRNA-424 inhibits osteosarcoma cell migration and invasion via targeting fatty acid synthase. Exp Ther Med. 2013 Apr;5(4):1048-1052.
|
| REF 4 |
Computational and in vitro Investigation of miRNA-Gene Regulations in Retinoblastoma Pathogenesis: miRNA Mimics Strategy. Bioinform Biol Insights. 2015 May 12;9:89-101.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
